Skip to main content
Addgene

pSCIP-hTRAC
(Plasmid #154094)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154094 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQCi
  • Backbone manufacturer
    Derived from pX458 (Zhang lab)
  • Backbone size w/o insert (bp) 9500
  • Modifications to backbone
    Modular BAIT site integrated (BsaI sites) Intron integrated into spCas9 sequence
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    GFP and tdTomato
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA and BAIT targeting human TRAC locus
  • Alt name
    TCTCTCAGCTGGTACACGGC
  • Species
    H. sapiens (human)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCIP-hTRAC was a gift from Scott McComb (Addgene plasmid # 154094 ; http://n2t.net/addgene:154094 ; RRID:Addgene_154094)
  • For your References section:

    Self-Cutting and Integrating CRISPR Plasmids Enable Targeted Genomic Integration of Genetic Payloads for Rapid Cell Engineering. Bloemberg D, Sosa-Miranda CD, Nguyen T, Weeratna RD, McComb S. CRISPR J. 2021 Feb;4(1):104-119. doi: 10.1089/crispr.2020.0090. 10.1089/crispr.2020.0090 PubMed 33616439