Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mOrange-P2A-hKvb1
(Plasmid #154084)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154084 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4579
  • Total vector size (bp) 6559
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mOrange-P2A-human Kvb1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1980
  • GenBank ID
    NM172159.2
  • Entrez Gene
    KCNAB1 (a.k.a. AKR6A3, KCNA1B, KV-BETA-1, Kvb1.3, hKvBeta3, hKvb3)
  • Promoter human synapsin 1

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAAACTCCCCTTCCCGGCCA
  • 3′ sequencing primer ggcattaaagcagcgtatcc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mOrange-P2A-hKvb1 was a gift from Michael Hoppa (Addgene plasmid # 154084 ; http://n2t.net/addgene:154084 ; RRID:Addgene_154084)
  • For your References section:

    The potassium channel subunit K(v)beta1 serves as a major control point for synaptic facilitation. Cho IH, Panzera LC, Chin M, Alpizar SA, Olveda GE, Hill RA, Hoppa MB. Proc Natl Acad Sci U S A. 2020 Nov 24;117(47):29937-29947. doi: 10.1073/pnas.2000790117. Epub 2020 Nov 9. 10.1073/pnas.2000790117 PubMed 33168717

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More