Skip to main content
Addgene

QuasAr-P2A-hKvb1
(Plasmid #154083)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154083 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFCK
  • Backbone size w/o insert (bp) 9235
  • Total vector size (bp) 12160
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    QuasAr-P2A-human Kvb1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2925
  • GenBank ID
    NM172159.2
  • Entrez Gene
    KCNAB1 (a.k.a. AKR6A3, KCNA1B, KV-BETA-1, Kvb1.3, hKvBeta3, hKvb3)
  • Promoter CaMKII
  • Tag / Fusion Protein
    • myc-Flag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gcctctttgccccacttaat
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    QuasAr-P2A-hKvb1 was a gift from Michael Hoppa (Addgene plasmid # 154083 ; http://n2t.net/addgene:154083 ; RRID:Addgene_154083)

  • For your References section:

    The potassium channel subunit K(v)beta1 serves as a major control point for synaptic facilitation. Cho IH, Panzera LC, Chin M, Alpizar SA, Olveda GE, Hill RA, Hoppa MB. Proc Natl Acad Sci U S A. 2020 Nov 24;117(47):29937-29947. doi: 10.1073/pnas.2000790117. Epub 2020 Nov 9. 10.1073/pnas.2000790117 PubMed 33168717

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More
Related items: