QuasAr-P2A-GCaMP
(Plasmid
#154082)
-
PurposeIndependent expression of QuasAr and GCaMP under human synapsin 1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4578
- Total vector size (bp) 7542
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQuasAr-P2A-GCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)2964
-
MutationChanged Tyrosine 327 to Alanine
- Promoter human synapsin 1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer caaactccccttcccggcca
- 3′ sequencing primer ggcattaaagcagcgtatcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
QuasAr-P2A-GCaMP was a gift from Michael Hoppa (Addgene plasmid # 154082 ; http://n2t.net/addgene:154082 ; RRID:Addgene_154082) -
For your References section:
The potassium channel subunit K(v)beta1 serves as a major control point for synaptic facilitation. Cho IH, Panzera LC, Chin M, Alpizar SA, Olveda GE, Hill RA, Hoppa MB. Proc Natl Acad Sci U S A. 2020 Nov 24;117(47):29937-29947. doi: 10.1073/pnas.2000790117. Epub 2020 Nov 9. 10.1073/pnas.2000790117 PubMed 33168717