QuasAr-P2A-GCaMP
(Plasmid #154082)

• Purpose: Independent expression of QuasAr and GCaMP under human synapsin 1 promoter
• Depositing Lab: Michael Hoppa
• Publication: Cho et al Proc Natl Acad Sci U S A. 2020 Nov 24;117(47):29937-29947. doi: 10.1073/pnas.2000790117. Epub 2020 Nov 9.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4578
• Total vector size (bp): 7542
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: QuasAr-P2A-GCaMP6f
• Species: Synthetic
• Insert Size (bp): 2964
• Mutation: Changed Tyrosine 327 to Alanine
• Promoter: human synapsin 1

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: caaactccccttcccggcca
• 3′ sequencing primer: ggcattaaagcagcgtatcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry