pMG051 MBP-β-catenin-His, GST-CK1α
(Plasmid #154072)

• Purpose: Co-expresses MBP-β-catenin-His (human β-catenin as a fusion protein with MBP and His- tags) and GST_CK1α in E.coli to produce primed MBP-β-catenin-His
• Depositing Lab: Jesse Zalatan
• Publication: Gavagan et al Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17.

Backbone

• Vector backbone: pMBP-MG
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6716
• Total vector size (bp): 10852
• Modifications to backbone: Modified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: CTNNB1
• Alt name: β-catenin
• Alt name: Beta-catenin
• Species: H. sapiens (human)
• Insert Size (bp): 2343
• GenBank ID: AY463360
• Entrez Gene: CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
• Promoter: Tac
• Tags / Fusion Proteins:
  • MBP (N terminal on backbone)
  • His6 (C terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: MalE Forward GGTCGTCAGACTGTCGATGAAGCC
• 3′ sequencing primer: GST_N Reverse GAGTGGGTTGCACAAG

Gene/Insert 2

• Gene/Insert name: CSNK1A1
• Alt name: Casein kinase I isoform alpha
• Insert Size (bp): 1014
• GenBank ID: AK294942
• Entrez Gene: CSNK1A1 (a.k.a. CK1, CK1a, CKIa, HEL-S-77p, HLCDGP1, PRO2975)
• Promoter: Tac
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: M13F Reverse TGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pMG051_pMBP_Bcatenin_GST_CK1acoexpressionvectorape.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene #14753, Addgene #92014

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

BamHI restriction site between MBP and B-catenin insert, NotI restriction site between B-catenin insert and His6-tag, SalI restriction site between GST and CK1a insert, PstI restriction site after CK1a stop.