EC71173
(Plasmid
#154061)
-
PurposeLevel 1, Position 2 Golden Gate vector. HspHv17::Cre-U5-Cre
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEC47811 (pL1V-R2-47811)
-
Backbone manufacturerEngineering Nitrogen Symbiosis for Africa (ENSA)
- Backbone size w/o insert (bp) 4290
- Total vector size (bp) 6509
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Alt nameCre-U5-Cre
-
SpeciesEnterobacteria phage P1
-
Insert Size (bp)2133
-
MutationIntroduction of U5 intron sequences, to prevent premature activation during cloning.
-
GenBank ID2777477
- Promoter HvHSP17
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
- 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EC71173 was a gift from Cristobal Uauy (Addgene plasmid # 154061 ; http://n2t.net/addgene:154061 ; RRID:Addgene_154061) -
For your References section:
A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173