pLOXp-GUS
(Plasmid
#154059)
-
PurposeLevel 0.5 Golden Gate vector, loxP-GUS-nosT-loxP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEC10161
-
Backbone manufacturerEngineering Nitrogen Symbiosis for Africa (ENSA)
- Backbone size w/o insert (bp) 2503
- Total vector size (bp) 4791
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebeta-glucoronidase (E. coli)
-
Alt nameGUS
-
SpeciesE. coli
-
Insert Size (bp)2283
- Promoter N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer tgcacgtctcatactgacct
- 3′ sequencing primer gcgtctcacattcaaccctt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypICH7511
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLOXp-GUS was a gift from Cristobal Uauy (Addgene plasmid # 154059 ; http://n2t.net/addgene:154059 ; RRID:Addgene_154059) -
For your References section:
A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173