pNB1-LOX
(Plasmid #154058)

• Purpose: Level 1, Position 3 Golden Gate vector. ZmUbi-5'UTR:loxP-GUS-nosT-loxP-NAM-B1-nosT
• Depositing Lab: Cristobal Uauy
• Publication: Harrington et al Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020.

Backbone

• Vector backbone: pICH47751
• Backbone size w/o insert (bp): 4356
• Total vector size (bp): 10545
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LoxP-flanked GUS and TtNAM-B1
• Alt name: ZmUbi::loxP-GUS-nosT-loxP-NAM-B1-nosT
• Species: Triticum turgidum ssp. dicoccoides (NAM-B1) and Escherichia coli (GUS)
• Insert Size (bp): 6169
• Mutation: The TtNAM-B1 gene sequence was domesticated to remove any BbsI or BsaI sites. One BbsI site was identified and was domesticated from “GTCTTC” to “ATCGTC”, removing the enzyme cut site but retaining the correct amino acid sequence. The exonic sequence is based on the sequence of NAM-B1 from T. turgidum ssp. dicoccoides, while the intronic sequence is taken from the non-functional copy of NAM-B1 present in Chinese Spring.
• GenBank ID: DQ869673.1
• Promoter: ZmUbi

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: CTGGTGGCAGGATATATTGTGGTG
• 3′ sequencing primer: GAACCCTGTGGTTGGCATGCACATAC

Resource Information

• Supplemental Documents:
  • pnb1-lox.gb
• A portion of this plasmid was derived from a plasmid made by: The promoter sequence and 5' UTR are derived from pICSL12009, the GUS coding sequence is derived from pICH7511, both shared by Nicola Patron. The LoxP sites are derived from the ENSA construct EC10161.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry