enz.043-SETD7-Y305F
(Plasmid
#154045)
-
PurposeExpresses SETD7 (Y305F) in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAJM.029
- Backbone size w/o insert (bp) 2283
- Total vector size (bp) 5246
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHistone-lysine N-methyltransferase SETD7
-
Alt nameSET7
-
Alt nameSET9
-
Alt nameSET7/9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2283
-
Mutationchanged tyrosine 305 to phenylalanine
-
GenBank ID80854
-
Entrez GeneSETD7 (a.k.a. KMT7, SET7, SET7/9, SET9)
- Promoter T7
-
Tags
/ Fusion Proteins
- His, MBP (N terminal on insert)
- His, MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAATTCGCTGCAGCTTCTAGAGTAATACG
- 3′ sequencing primer GCTACTAGTATATAAACGCAGAAAGGCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
enz.043-SETD7-Y305F was a gift from Christopher Voigt (Addgene plasmid # 154045 ; http://n2t.net/addgene:154045 ; RRID:Addgene_154045) -
For your References section:
Silica Nanostructures Produced Using Diatom Peptides with Designed Post-Translational Modifications. Wallace AK, Chanut N, Voigt CA. Advanced Functional Materials 2020 10.1002/adfm.202000849