pDONR207 SARS-CoV-2 NSP3 Cys857Ala
(Plasmid
#154027)
-
PurposeGateway-compatible Entry vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154027 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepDONR207
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5585
-
Vector typeGateway-compatible Entry vector, with mutagenized insert of NSP3 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNSP3
-
Alt namePLPRO
-
SpeciesSARS-CoV-2 isolate Wuhan-Hu-1
-
Insert Size (bp)5841
-
MutationMany synonymous changes due to codon optimization
-
GenBank ID
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCT
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR207 SARS-CoV-2 NSP3 Cys857Ala was a gift from Fritz Roth (Addgene plasmid # 154027 ; http://n2t.net/addgene:154027 ; RRID:Addgene_154027) -
For your References section:
A Comprehensive, Flexible Collection of SARS-CoV-2 Coding Regions. Kim DK, Knapp JJ, Kuang D, Chawla A, Cassonnet P, Lee H, Sheykhkarimli D, Samavarchi-Tehrani P, Abdouni H, Rayhan A, Li R, Pogoutse O, Coyaud E, van der Werf S, Demeret C, Gingras AC, Taipale M, Raught B, Jacob Y, Roth FP. G3 (Bethesda). 2020 Aug 6. pii: g3.120.401554. doi: 10.1534/g3.120.401554. 10.1534/g3.120.401554 PubMed 32763951