Skip to main content
Addgene

pMG023 MBP-Axin 384-518-His (miniAxin)
(Plasmid #154012)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154012 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMBP-MG
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6716
  • Total vector size (bp) 7121
  • Modifications to backbone
    Modified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Axin1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    405
  • Mutation
    381-518 fragment
  • GenBank ID
    BC000251
  • Entrez Gene
    AXIN1 (a.k.a. AXIN, PPP1R49)
  • Promoter Tac
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer MalE Forward GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer M13F Reverse TGTAAAACGACGGCCAGT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMG023 MBP-Axin 384-518-His (miniAxin) was a gift from Jesse Zalatan (Addgene plasmid # 154012 ; http://n2t.net/addgene:154012 ; RRID:Addgene_154012)

  • For your References section:

    The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184
Related items:
Commonly requested with: