pEF073 MBP-Axin-His
(Plasmid #154011)

• Purpose: Expresses MBP-Axin-His (human Axin as a fusion protein with MBP and His- tags) in E.coli
• Depositing Lab: Jesse Zalatan
• Publication: Gavagan et al Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17.

Backbone

• Vector backbone: pMBP-MG
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6716
• Total vector size (bp): 9194
• Modifications to backbone: Modified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Axin1
• Species: H. sapiens (human)
• Insert Size (bp): 2478
• GenBank ID: BC000251
• Entrez Gene: AXIN1 (a.k.a. AXIN, PPP1R49)
• Promoter: tac
• Tags / Fusion Proteins:
  • MBP (N terminal on backbone)
  • His6 (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: MalE Forward GGTCGTCAGACTGTCGATGAAGCC
• 3′ sequencing primer: M13F Reverse TGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pEF073_pMBP_Axin_FL.gb
• A portion of this plasmid was derived from a plasmid made by: Derived from hAxin1-rLuc, a gift from Randall Moon

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry