LeGO-Luc2
(Plasmid #154006)

• Purpose: Lentiviral vector expressing firefly luciferase (Luc2)
• Depositing Lab: Boris Fehse
• Publication: Ellinger et al Viruses. 2020 May 25;12(5). pii: v12050580. doi: 10.3390/v12050580.

Backbone

• Vector backbone: LeGO vector
• Backbone manufacturer: Kristoffer Riecken
• Backbone size w/o insert (bp): 6395
• Total vector size (bp): 8048
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Any E. coli strain used for cloning should work (Top10, XL10gold, DH10B or other).
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly Luciferase
• Alt name: Luc2
• Species: Firefly
• Insert Size (bp): 1653
• Promoter: SFFV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GAGCTCACAACCCCTCACTC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a 3rd generation SIN lentiviral vector, expressing firefly luciferase (variant Luc2). The SFFV promoter is a strong and ubiquitous viral promoter derived from spleen focus-forming virus, working in murine and human cells. For packaging, use 2nd or 3rd generation packaging plasmids.