BFP-Dcp1a
(Plasmid #153973)

• Purpose: Fluorescent protein fused to mRNA decapping enzyme 1a
• Depositing Lab: Gia Voeltz
• Publication: Lee et al Science. 2020 Jan 31;367(6477). pii: 367/6477/eaay7108. doi: 10.1126/science.aay7108.

Backbone

• Vector backbone: pAcGFP-c1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4721
• Total vector size (bp): 6429
• Modifications to backbone: GFP was replaced with BFP (mTagBFP-c1) using XhoI and KpnI
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mRNA decapping enzyme 1a
• Alt name: Dcp1a
• Species: H. sapiens (human)
• Insert Size (bp): 1746
• Entrez Gene: DCP1A (a.k.a. HSA275986, Nbla00360, SMAD4IP1, SMIF)
• Tag / Fusion Protein:
  • mTagBFP-c1 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGAGACCTACGTCGAGCAGC
• 3′ sequencing primer: GGTGTGGGAGGTTTTTTAAAGC

Resource Information

• Supplemental Documents:
  • BFP-Dcp1a.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry