Skip to main content
Addgene

pCsy1-Csy2
(Plasmid #153942)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153942 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    px601
  • Backbone size w/o insert (bp) 3178
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Csy1, Csy2
  • Species
    Synthetic; Pseudomonas aeruginosa
  • Insert Size (bp)
    1401
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TCCAAACTCATCAATGTATC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCsy1-Csy2 was a gift from Zhou Songyang (Addgene plasmid # 153942 ; http://n2t.net/addgene:153942 ; RRID:Addgene_153942)

  • For your References section:

    Repurposing type I-F CRISPR-Cas system as a transcriptional activation tool in human cells. Chen Y, Liu J, Zhi S, Zheng Q, Ma W, Huang J, Liu Y, Liu D, Liang P, Songyang Z. Nat Commun. 2020 Jun 19;11(1):3136. doi: 10.1038/s41467-020-16880-8. 10.1038/s41467-020-16880-8 PubMed 32561716
Related items:
Commonly requested with: