Addgene: pQsupR Skip to main content
Addgene

pQsupR
(Plasmid #15378)

Full plasmid sequence is not available for this item.

Created with RaphaëlpQsupRhuman H1 promot…

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15378 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRVGP
  • Backbone manufacturer
    Smale lab
  • Backbone size w/o insert (bp) 8017
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human H1 promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    269

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer gttcctgaccttgatctgaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQsupR was a gift from Stephen Smale (Addgene plasmid # 15378 ; http://n2t.net/addgene:15378 ; RRID:Addgene_15378)
  • For your References section:

    Selective and antagonistic functions of SWI/SNF and Mi-2beta nucleosome remodeling complexes during an inflammatory response. Ramirez-Carrozzi VR, Nazarian AA, Li CC, Gore SL, Sridharan R, Imbalzano AN, Smale ST. Genes Dev. 2006 Feb 1. 20(3):282-96. 10.1101/gad.1383206 PubMed 16452502