pEvol-MjaYRS
(Plasmid #153557)

• Purpose: Amber suppression for incorporating 3-aminotyrosine to proteins in E. coli
• Depositing Lab: Huiwang Ai
• Publication: Zhang et al Nat Chem Biol. 2020 Sep 14. pii: 10.1038/s41589-020-0641-7. doi: 10.1038/s41589-020-0641-7.

Backbone

• Vector backbone: pEvol
• Total vector size (bp): 6125
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: MJaYRS (first copy)
• Alt name: 3-amino-tyrosine synthetase derived from archea Methanococcus jannaschii
• Species: archea Methanococcus jannaschii
• Insert Size (bp): 921
• GenBank ID:
• Promoter: pBAD

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Gene/Insert 2

• Gene/Insert name: MJaYRS (second copy)
• Alt name: 3-amino-tyrosine synthetase derived from archea Methanococcus jannaschii
• Promoter: glnS

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: CGAGAGTAGGGAACTGCCAG
• 3′ sequencing primer: CGCTGAACGCGGCGTTTTGG

Gene/Insert 3

• Gene/Insert name: amber suppression tRNA under proK promoter
• Species: Synthetic

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Our further research identified that the unwanted oxidation of 3-amino-L-tyrosine by oxygen in the air might cause variations in incorporation efficiency, resulting in green impurities. Best results were obtained by using a medium volume equal to ~1/5 of the container marked volume (i.e. 100 mL for a 500-mL flask), inducing the expression and adding 4 mM 3-amino-L-tyrosine at OD600=1.2, and then sealing the flask for shaking at 30C for additional 48 h. In addition, an E222H mutation to sfGFP can significantly increase the brightness of the red fluorescence.