Skip to main content
Addgene

PDI-QUAD-V5-pcDNA3.1
(Plasmid #153550)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153550 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Protein disulphide isomerase
  • Alt name
    PDI-QUAD
  • Species
    H. sapiens (human)
  • Mutation
    C53S, C56S, C397S, C400S
  • Promoter pCMV
  • Tag / Fusion Protein
    • V5 tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CTCGACAAAGATGGGGTTGT
  • 3′ sequencing primer -TGCTCAGTTTGCCCGTCATAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PDI-QUAD-V5-pcDNA3.1 was a gift from Julie Atkin (Addgene plasmid # 153550 ; http://n2t.net/addgene:153550 ; RRID:Addgene_153550)

  • For your References section:

    The Redox Activity of Protein Disulfide Isomerase Inhibits ALS Phenotypes in Cellular and Zebrafish Models. Parakh S, Shadfar S, Perri ER, Ragagnin AMG, Piattoni CV, Fogolin MB, Yuan KC, Shahheydari H, Don EK, Thomas CJ, Hong Y, Comini MA, Laird AS, Spencer DM, Atkin JD. iScience. 2020 May 22;23(5):101097. doi: 10.1016/j.isci.2020.101097. Epub 2020 Apr 25. 10.1016/j.isci.2020.101097 PubMed 32446203
Related items:
Commonly requested with: