Skip to main content
Addgene

pAAV-EF1α1.1-FLEX-rc [ChromeQ-GFP]
(Plasmid #153542)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153542 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV- EF1α1.1-FLEX
  • Backbone manufacturer
    Epoch
  • Backbone size w/o insert (bp) 5367
  • Total vector size (bp) 7032
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChromeQ-GFP
  • Alt name
    Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G/R115S
  • Species
    Synthetic
  • Insert Size (bp)
    1665
  • GenBank ID
  • Promoter EF1α1.1
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggatcttggttcattctcaag
  • 3′ sequencing primer aaagagacagcaaccagg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α1.1-FLEX-rc [ChromeQ-GFP] was a gift from Edward Boyden (Addgene plasmid # 153542 ; http://n2t.net/addgene:153542 ; RRID:Addgene_153542)

  • For your References section:

    Multidimensional screening yields channelrhodopsin variants having improved photocurrent and order-of-magnitude reductions in calcium and proton currents. Cho YK, Park D, Yang A, Chen F, Chuong AS, Klapoetke NC, Boyden ES. J Biol Chem. 2019 Jan 4. pii: RA118.006996. doi: 10.1074/jbc.RA118.006996. 10.1074/jbc.RA118.006996 PubMed 30610117
Related items: