Skip to main content
Addgene

pAAV-Syn-FLEX-rc [ChromeT-GFP]
(Plasmid #153539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Syn-FLEX
  • Backbone size w/o insert (bp) 4630
  • Total vector size (bp) 6295
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChromeT-GFP
  • Alt name
    Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G
  • Species
    Synthetic
  • Insert Size (bp)
    1665
  • GenBank ID
  • Promoter Syn
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer TAGCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-FLEX-rc [ChromeT-GFP] was a gift from Edward Boyden (Addgene plasmid # 153539 ; http://n2t.net/addgene:153539 ; RRID:Addgene_153539)
  • For your References section:

    Multidimensional screening yields channelrhodopsin variants having improved photocurrent and order-of-magnitude reductions in calcium and proton currents. Cho YK, Park D, Yang A, Chen F, Chuong AS, Klapoetke NC, Boyden ES. J Biol Chem. 2019 Jan 4. pii: RA118.006996. doi: 10.1074/jbc.RA118.006996. 10.1074/jbc.RA118.006996 PubMed 30610117