Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-EF1α1.1-Jaws-KGC-GFP-ER2
(Plasmid #153537)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153537 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV- EF1α1.1
  • Backbone manufacturer
    Epoch
  • Backbone size w/o insert (bp) 5396
  • Total vector size (bp) 7049
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Jaws-KGC-GFP-ER2
  • Alt name
    Jaws
  • Alt name
    Jaws-KGC-GFP-ER2
  • Alt name
    Halo57
  • Species
    Haloarcula salinarum (stain Shark)
  • Insert Size (bp)
    1653
  • Mutation
    K200R W214F
  • GenBank ID
    KM000926.1
  • Promoter EF1α1.1
  • Tags / Fusion Proteins
    • KGC (C terminal on insert)
    • GFP (C terminal on insert)
    • ER2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ggatcttggttcattctcaag
  • 3′ sequencing primer aaagagacagcaaccagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α1.1-Jaws-KGC-GFP-ER2 was a gift from Edward Boyden (Addgene plasmid # 153537 ; http://n2t.net/addgene:153537 ; RRID:Addgene_153537)
  • For your References section:

    Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Chuong AS, Miri ML, Busskamp V, Matthews GA, Acker LC, Sorensen AT, Young A, Klapoetke NC, Henninger MA, Kodandaramaiah SB, Ogawa M, Ramanlal SB, Bandler RC, Allen BD, Forest CR, Chow BY, Han X, Lin Y, Tye KM, Roska B, Cardin JA, Boyden ES. Nat Neurosci. 2014 Aug;17(8):1123-9. doi: 10.1038/nn.3752. Epub 2014 Jul 6. 10.1038/nn.3752 PubMed 24997763