AAV-Syn-Jaws-KGC-tdTomato-ER2
(Plasmid
#153535)
-
PurposeAAV-mediated expression of Jaws-KGC-tdTomato-ER2 under the Syn promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-Syn
- Backbone size w/o insert (bp) 4193
- Total vector size (bp) 6557
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJaws-KGC-tdTomato-ER2
-
Alt nameJaws
-
Alt nameJaws-KGC-tdTomato-ER2
-
Alt nameHalo57
-
SpeciesHaloarcula salinarum (stain Shark)
-
Insert Size (bp)2364
-
MutationK200R W214F
-
GenBank IDKM000926.1
- Promoter Syn
-
Tags
/ Fusion Proteins
- KGC (C terminal on insert)
- tdTomato (C terminal on insert)
- ER2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gcacgggcgcgaccatctgc
- 3′ sequencing primer TAGCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Syn-Jaws-KGC-tdTomato-ER2 was a gift from Edward Boyden (Addgene plasmid # 153535 ; http://n2t.net/addgene:153535 ; RRID:Addgene_153535) -
For your References section:
Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Chuong AS, Miri ML, Busskamp V, Matthews GA, Acker LC, Sorensen AT, Young A, Klapoetke NC, Henninger MA, Kodandaramaiah SB, Ogawa M, Ramanlal SB, Bandler RC, Allen BD, Forest CR, Chow BY, Han X, Lin Y, Tye KM, Roska B, Cardin JA, Boyden ES. Nat Neurosci. 2014 Aug;17(8):1123-9. doi: 10.1038/nn.3752. Epub 2014 Jul 6. 10.1038/nn.3752 PubMed 24997763