lvl0 ACT2t
(Plasmid
#153384)
-
PurposePlant terminator
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemUAV
- Backbone size w/o insert (bp) 2053
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACT2 terminator
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)228
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AarI (destroyed during cloning)
- 3′ cloning site AarI (destroyed during cloning)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lvl0 ACT2t was a gift from Naomi Nakayama (Addgene plasmid # 153384 ; http://n2t.net/addgene:153384 ; RRID:Addgene_153384) -
For your References section:
Mobius Assembly for Plant Systems highlights promoter-terminator interaction in gene regulation. Andreou , Andreas I., Nirkko, Jessica , Ochoa-Villarreal, Marisol , Nakayama, Naomi. bioRxiv, March 31, 2021 10.1101/2021.03.31.437819