lvl0 G10-90p
(Plasmid #153370)

• Purpose: Synthetic promoter for plant expression
• Depositing Lab: Naomi Nakayama
• Publication: Andreou et al bioRxiv, March 31, 2021

Backbone

• Vector backbone: mUAV
• Backbone size w/o insert (bp): 2053
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: G10-90 promoter
• Species: Synthetic
• Insert Size (bp): 239

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AarI (destroyed during cloning)
• 3′ cloning site: AarI (destroyed during cloning)
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Resource Information

• Supplemental Documents:
  • lvl0 G10-90p.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note there is one ambiguous base in the CaMV 35S promoter. This base pair is a mixed population of an A and T. Depositor confirms this mixed population does not affect plasmid function.