Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCgsgRNA_crtYf
(Plasmid #153338)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153338 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJYS2_crtYf
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    crRNA targeting crtYf
  • gRNA/shRNA sequence
    ctgcgtttaaacatatttcc
  • Species
    Other

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCgsgRNA_crtYf was a gift from Sheng Yang (Addgene plasmid # 153338 ; http://n2t.net/addgene:153338 ; RRID:Addgene_153338)
  • For your References section:

    De Novo Engineering of Corynebacterium glutamicum for l-Proline Production. Zhang J, Qian F, Dong F, Wang Q, Yang J, Jiang Y, Yang S. ACS Synth Biol. 2020 Jul 17;9(7):1897-1906. doi: 10.1021/acssynbio.0c00249. Epub 2020 Jul 6. 10.1021/acssynbio.0c00249 PubMed 32627539