Skip to main content
Addgene

pLVX-anti-MIR328-3p
(Plasmid #153319)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153319 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLVX-Che-hi3
  • Backbone manufacturer
    Sanford Simon
  • Backbone size w/o insert (bp) 8230
  • Total vector size (bp) 9073
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    zsGreen with MIR328-3p sponge
  • Species
    Synthetic
  • Insert Size (bp)
    881
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlu1 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTTTTGAAGCGTGCAGAATG
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pHIV-zsGreen (a gift from Bryan Welm & Zena Werb (Addgene plasmid # 18121)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-anti-MIR328-3p was a gift from Robert Judson-Torres (Addgene plasmid # 153319 ; http://n2t.net/addgene:153319 ; RRID:Addgene_153319)

  • For your References section:

    BRAF(V600E) induces reversible mitotic arrest in human melanocytes via microrna-mediated suppression of AURKB. McNeal AS, Belote RL, Zeng H, Urquijo M, Barker K, Torres R, Curtin M, Shain AH, Andtbacka RH, Holmen S, Lum DH, McCalmont TH, VanBrocklin MW, Grossman D, Wei ML, Lang UE, Judson-Torres RL. Elife. 2021 Nov 23;10. pii: 70385. doi: 10.7554/eLife.70385. 10.7554/eLife.70385 PubMed 34812139
Related items: