Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVX-Phi3-AURKB-PGK-mCherry
(Plasmid #153316)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 153316 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX-Che-hi3
  • Backbone manufacturer
    Sanford Simon
  • Backbone size w/o insert (bp) 8230
  • Total vector size (bp) 9271
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AURKB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1035
  • Entrez Gene
    AURKB (a.k.a. AIK2, AIM-1, AIM1, ARK-2, ARK2, AurB, IPL1, PPP1R48, STK-1, STK12, STK5, aurkb-sv1, aurkb-sv2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlu1 (not destroyed)
  • 3′ cloning site BAMH1 (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTTTTGAAGCGTGCAGAATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-Phi3-AURKB-PGK-mCherry was a gift from Robert Judson-Torres (Addgene plasmid # 153316 ; http://n2t.net/addgene:153316 ; RRID:Addgene_153316)
  • For your References section:

    BRAF(V600E) induces reversible mitotic arrest in human melanocytes via microrna-mediated suppression of AURKB. McNeal AS, Belote RL, Zeng H, Urquijo M, Barker K, Torres R, Curtin M, Shain AH, Andtbacka RH, Holmen S, Lum DH, McCalmont TH, VanBrocklin MW, Grossman D, Wei ML, Lang UE, Judson-Torres RL. Elife. 2021 Nov 23;10. pii: 70385. doi: 10.7554/eLife.70385. 10.7554/eLife.70385 PubMed 34812139