pT2-TetR-neoR
(Plasmid
#153310)
-
PurposeTet-repressor with neomycin selection marker, to be used together with pT2-CMV/TetO2-EYFP-GW
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepT2/HB
- Backbone size w/o insert (bp) 3558
- Total vector size (bp) 7086
-
Vector typeTransposon
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetR
-
SpeciesSynthetic
-
Insert Size (bp)1883
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer actagtccatagagcccacc
- 3′ sequencing primer actagtctgtggaatgtgtg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2-TetR-neoR was a gift from Spyros Petrakis (Addgene plasmid # 153310 ; http://n2t.net/addgene:153310 ; RRID:Addgene_153310) -
For your References section:
Nuclear inclusions of pathogenic ataxin-1 induce oxidative stress and perturb the protein synthesis machinery. Laidou S, Alanis-Lobato G, Pribyl J, Rasko T, Tichy B, Mikulasek K, Tsagiopoulou M, Oppelt J, Kastrinaki G, Lefaki M, Singh M, Zink A, Chondrogianni N, Psomopoulos F, Prigione A, Ivics Z, Pospisilova S, Skladal P, Izsvak Z, Andrade-Navarro MA, Petrakis S. Redox Biol. 2020 Feb 11;32:101458. doi: 10.1016/j.redox.2020.101458. 10.1016/j.redox.2020.101458 PubMed 32145456