pLVX-EF1α-ZC3H12D-D95N-IRES-EGFP
(Plasmid
#153071)
-
PurposeLentiviral vector expressing human ZC3H12D mutated (D95N)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153071 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVX-EF1α-IRES-EGFP
-
Backbone manufacturerGENECOPOEIA
- Backbone size w/o insert (bp) 7349
- Total vector size (bp) 8933
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMutated ZC3H12D (D95N)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1584
-
MutationChanged D95 to N, known to abrogate the RNase enzymatic activity
-
Entrez GeneZC3H12D (a.k.a. C6orf95, MCPIP4, TFL, dJ281H8.1, p34)
- Promoter EF1α
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTCCACGCTTTGCCTGACCCTGCTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original wild-type, unmutated vector was purchased from GENECOPOEIA (catalog number EX-Y4955-Lv165). Starting from this vector, amino acid D95 was mutated to N.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-EF1α-ZC3H12D-D95N-IRES-EGFP was a gift from Silvia Monticelli (Addgene plasmid # 153071 ; http://n2t.net/addgene:153071 ; RRID:Addgene_153071) -
For your References section:
A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878