pGL3-Enhancer-ZC3H12D_PromoterMUT
(Plasmid #153068)

• Purpose: ZC3H12D promoter region carrying mutations in BHLHE40 binding sites, cloned upstream of luciferase reporter
• Depositing Lab: Silvia Monticelli
• Publication: Emming et al Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16.

Backbone

• Vector backbone: pGL3-Enhancer
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5059
• Total vector size (bp): 5694
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZC3H12D promoter region mutated in BHLHE40 binding sites
• Species: H. sapiens (human)
• Insert Size (bp): 635
• Mutation: Mutagenesis to disrupt 3 BHLHE40 binding sites. New BamHI, EcoRI and EcoRV restriction sites were inserted by mutagenesis disrupting binding sites at position 185, 337 and 436 of the insert.
• Entrez Gene: ZC3H12D (a.k.a. C6orf95, MCPIP4, TFL, dJ281H8.1, p34)
• Promoter: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: Unavailable
• 3′ sequencing primer: CTTTATGTTTTTGGCGTCTTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There exist several polymorphisms in the promoter region that do not functionally impact the plasmid. They represent discrepancies compared to the human reference genome (hg38).