Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL3-Basic-ZC3H12D_PromoterMUT
(Plasmid #153067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153067 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4813
  • Total vector size (bp) 5448
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZC3H12D promoter region mutated in BHLHE40 binding sites
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    635
  • Mutation
    Mutagenesis to disrupt 3 BHLHE4040 binding sites. New BamHI, EcoRI and EcoRV restriction sites were inserted by mutagenesis disrupting binding sites at position 185, 337 and 436 of the insert.
  • Entrez Gene
    ZC3H12D (a.k.a. C6orf95, MCPIP4, TFL, dJ281H8.1, p34)
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Unavailable
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There exist several polymorphisms in the promoter region that do not functionally impact the plasmid. They represent discrepancies compared to the human reference genome (hg38).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Basic-ZC3H12D_PromoterMUT was a gift from Silvia Monticelli (Addgene plasmid # 153067 ; http://n2t.net/addgene:153067 ; RRID:Addgene_153067)
  • For your References section:

    A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878