Skip to main content
Addgene

pGL3-Enhancer-ZC3H12D_PromoterWT
(Plasmid #153066)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153066 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL3-Enhancer
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5059
  • Total vector size (bp) 5694
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZC3H12D promoter region
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    635
  • Entrez Gene
    ZC3H12D (a.k.a. C6orf95, MCPIP4, TFL, dJ281H8.1, p34)
  • Promoter none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Unavailable
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There exist polyT and C674 discrepancies in the promoter region that do not functionally impact the plasmid. They represent discrepancies compared to the human reference genome (hg38).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Enhancer-ZC3H12D_PromoterWT was a gift from Silvia Monticelli (Addgene plasmid # 153066 ; http://n2t.net/addgene:153066 ; RRID:Addgene_153066)

  • For your References section:

    A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878
Related items: