ACE2 g1 + Cas9
(Plasmid #153011)

• Purpose: A guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2
• Depositing Lab: Jason Sheltzer
• Publication: CRISPR plasmids to knock out SARS-CoV-2 host genes (unpublished)

Backbone

• Vector backbone: Lenti-Cas9-gRNA-TagBFP2 (Addgene #124774)
• Vector type: Lentiviral, CRISPR
• Selectable markers: TagBFP2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9 + ACE2 gRNA
• Alt name: ACE2
• gRNA/shRNA sequence: ACCTGGGGAAGGGCGACTTC
• Species: H. sapiens (human)
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Tag / Fusion Protein:
  • TagBFP2

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Information for Lentiviral Prep (Catalog # 153011-LV)

Purpose

Ready-to-use Lentiviral Prep particles produced from ACE2 g1 + Cas9 (#153011). In addition to the viral particles, you will also receive purified ACE2 g1 + Cas9 plasmid DNA.

Lentiviral particles carrying a guide RNA targeting ACE2 and co-expressing Cas9 and TagBFP2.

Delivery

• Volume: 1mL
• Titer: ≥5x10⁵ TU/mL
• Pricing: $150 USD for preparation of 1mL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPro

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• ddPCR assay: 293T cells were transduced with serial dilutions of 153011-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.

Notes:

• PCR confirmation of insert: PCRs were carried out on the viral preparation with primers targeting the Cas9 and TagBFP genes to confirm inserts and primers targeting the EF1a promoter and the ACE2 guide to confirm the backbone and guide sequences. The PCR products were visualized on an agarose gel for size confirmation.

Visit our viral production page for more information.