pCAG CAG Glucagon-ICAM1-3xHA-pre-mGRASP
(Plasmid
#153008)
-
PurposeExpresses glucagon peptide on mammalian cell surface
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 5824
- Total vector size (bp) 8344
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGlucagon-ICAM1-pre-mGRASP
-
Insert Size (bp)2520
- Promoter CAG
-
Tag
/ Fusion Protein
- 3x HA
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcggctctagagcctctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG CAG Glucagon-ICAM1-3xHA-pre-mGRASP was a gift from Alice Ting (Addgene plasmid # 153008 ; http://n2t.net/addgene:153008 ; RRID:Addgene_153008) -
For your References section:
Split-TurboID enables contact-dependent proximity labeling in cells. Cho KF, Branon TC, Rajeev S, Svinkina T, Udeshi ND, Thoudam T, Kwak C, Rhee HW, Lee IK, Carr SA, Ting AY. Proc Natl Acad Sci U S A. 2020 May 18. pii: 1919528117. doi: 10.1073/pnas.1919528117. 10.1073/pnas.1919528117 PubMed 32424107