pSH1/M-FRBl2-E
(Plasmid #15289)

• Depositing Lab: David Spencer
• Publication: Li et al Gene Ther. 2002 Feb . 9(4):233-44.

Backbone

• Vector backbone: pSH1
• Backbone manufacturer: GR Crabtree lab
• Backbone size w/o insert (bp): 3500
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FRAP-rapamycin binding domain
• Alt name: mTOR
• Alt name: RAFT
• Alt name: FRAP
• Species: H. sapiens (human)
• Insert Size (bp): 630
• Mutation: res. 2025-2113, T2098L
• Entrez Gene: MTOR (a.k.a. FRAP, FRAP1, FRAP2, RAFT1, RAPT1, SKS)
• Tags / Fusion Proteins:
  • HA epitope (C terminal on insert)
  • Myristoylation-targeting domain c-Src (14aa) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI, SacII (not destroyed)
• 3′ cloning site: EcoRI, BamHI (not destroyed)
• 5′ sequencing primer: gaggtgttacttctgctctaaaagc
• 3′ sequencing primer: cactgcattctagttgtggtttg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry