pSH1/Mf-del-Akt-E
(Plasmid #15288)

• Depositing Lab: David Spencer
• Publication: Park et al Nat Biotechnol. 2006 Dec . 24(12):1581-90.

Backbone

• Vector backbone: pSH1
• Backbone manufacturer: GR Crabtree lab
• Backbone size w/o insert (bp): 3500
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: delPH-Akt
• Alt name: PKB
• Species: M. musculus (mouse)
• Insert Size (bp): 1240
• Mutation: Truncated PH (residues 1-99)
• Entrez Gene: Akt1 (a.k.a. Akt, LTR-akt, PKB, PKB/Akt, PKBalpha, Rac)
• Tags / Fusion Proteins:
  • HA epitope (C terminal on insert)
  • Myristoylation-targeting domain Fyn (16aa) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI, SacII (not destroyed)
• 3′ cloning site: EcoRI, BamHI (not destroyed)
• 5′ sequencing primer: gaggtgttacttctgctctaaaagc
• 3′ sequencing primer: cactgcattctagttgtggtttg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry