pSH1/S-Fvls-p30Casp9-E
(Plasmid #15272)

• Depositing Lab: David Spencer
• Publication: Fan et al Hum Gene Ther. 1999 Sep 20. 10(14):2273-85.

Backbone

• Vector backbone: pSH1
• Backbone manufacturer: GR Crabtree lab
• Backbone size w/o insert (bp): 3500
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FKBP12(V36)-p30Caspase9
• Alt name: iCaspase9
• Species: H. sapiens (human)
• Insert Size (bp): 1250
• Mutation: FKBP12 F36 to VTruncated Caspase9 (135-416; lacking pro-domain)
• GenBank ID: AH002818 NM_001229
• Entrez Gene: CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
• Tags / Fusion Proteins:
  • HA epitope (C terminal on insert)
  • Myristoylation-targeting domain c-Src (14aa) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI, SacII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: gaggtgttacttctgctctaaaagc
• 3′ sequencing primer: cactgcattctagttgtggtttg

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry