pNICE-NL2A
(Plasmid #15259)

• Depositing Lab: Peter Scheiffele
• Publication: Chih et al Neuron. 2006 Jul 20. 51(2):171-8.

Backbone

• Vector backbone: pNICE
• Backbone size w/o insert (bp): 4014
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Neuroligin 2 with insert A
• Alt name: Nlgn2A
• Alt name: Nlgn2
• Species: M. musculus (mouse)
• Insert Size (bp): 2637
• Entrez Gene: Nlgn2 (a.k.a. NL2, NLG2)
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtgt
• 3′ sequencing primer: catttgtagaggttttacttgctt

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry