pEGFP-GIT1
(Plasmid #15226)

• Depositing Lab: Rick Horwitz
• Publication: Manabe et al J Cell Sci. 2002 Apr 1. 115(Pt 7):1497-510.

Backbone

• Vector backbone: PEGFP-C1
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: G protein coupled receptor kinase-interacting protein 1
• Alt name: GIT1
• Species: H. sapiens (human)
• Insert Size (bp): 2300
• Mutation: L425V, E476K and L583P
• Entrez Gene: GIT1 (a.k.a. p95-APP1)
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac1 (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: EGFP-C sequencing primer
• 3′ sequencing primer: TTATAAGCTGCAATAAACAAGTT

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry