PB-CAG-mRuby3-Gal8-P2A-Zeo
(Plasmid #150815)

• Purpose: Mammalian expression of mRuby3-Galectin8 (Gal8) fusion protein
• Depositing Lab: Jordan Green
• Publication: Rui et al Sci Adv. 2022 Jan 7;8(1):eabk2855. doi: 10.1126/sciadv.abk2855.

Backbone

• Vector backbone: PB-CAG-GAPd2
• Backbone size w/o insert (bp): 6466
• Total vector size (bp): 7864
• Modifications to backbone: In-frame insertion of Gal8 to form c-terminus fusion protein with mRuby3 with P2A ribosomal skip site followed by zeocin resistance for mammalian selection
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mRuby3-Gal8-P2A-Zeo
• Alt name: Galectin-8
• Alt name: mRuby3
• Alt name: LGALS8
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2241
• GenBank ID: 3964
• Entrez Gene: LGALS8 (a.k.a. Gal-8, PCTA-1, PCTA1, Po66-CBP)
• Promoter: CAG
• Tag / Fusion Protein:
  • Gal8 is fused to the c-terminus of mRuby3 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: GCAACATATGCCCATATGCTGGC

Resource Information

• Supplemental Documents:
  • pb-cag-mruby-gal8-p2a-zeo.gb
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry