pSCALPS_miR-146aSponge_mCherry_GFP
(Plasmid #149718)

• Purpose: Lentiviral vector expressing a miR-146a decoy sponge
• Depositing Lab: Silvia Monticelli
• Publication: Emming et al Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16.

Backbone

• Vector backbone: pSCALPS_mCherry_GFP
• Backbone size w/o insert (bp): 8518
• Total vector size (bp): 8929
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 14X miR-146a binding sites
• Species: Synthetic
• Insert Size (bp): 411
• Mutation: G to T mutation in position 75 of the insert

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCCCGTAATGCAGAAGAAGA
• 3′ sequencing primer: GTTGTCAAGCGATGAGGCGCGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry