Skip to main content
Addgene

pSCALPS_miR-146aSponge_mCherry_GFP
(Plasmid #149718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149718 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSCALPS_mCherry_GFP
  • Backbone size w/o insert (bp) 8518
  • Total vector size (bp) 8929
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    14X miR-146a binding sites
  • Species
    Synthetic
  • Insert Size (bp)
    411
  • Mutation
    G to T mutation in position 75 of the insert

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCALPS_miR-146aSponge_mCherry_GFP was a gift from Silvia Monticelli (Addgene plasmid # 149718 ; http://n2t.net/addgene:149718 ; RRID:Addgene_149718)
  • For your References section:

    A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878