pNG1256
(Plasmid
#149710)
-
PurposeExpresses RpoA, RpoB, RpoC-9His and RpoZ from Bacillus subtilis to produce core RNAP complex
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNG219
-
Backbone manufacturerhttps://doi.org/10.1016/j.pep.2008.01.006
- Backbone size w/o insert (bp) 12971
- Total vector size (bp) 13243
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerpoZ
-
Alt nameyloH
-
Alt nameBSU_15690
-
GenBank ID
-
Entrez GenerpoZ (a.k.a. BSU_15690, BSU15690)
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGTTAAAGGCGACAATGTT
- 3′ sequencing primer ACGCCTTTATAACGAACTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNG1256 was a gift from Peter Lewis (Addgene plasmid # 149710 ; http://n2t.net/addgene:149710 ; RRID:Addgene_149710) -
For your References section:
Molecular basis for RNA polymerase-dependent transcription complex recycling by the helicase-like motor protein HelD. Newing TP, Oakley AJ, Miller M, Dawson CJ, Brown SHJ, Bouwer JC, Tolun G, Lewis PJ. Nat Commun. 2020 Dec 18;11(1):6420. doi: 10.1038/s41467-020-20157-5. 10.1038/s41467-020-20157-5 PubMed 33339820