Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNG1256
(Plasmid #149710)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149710 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNG219
  • Backbone manufacturer
    https://doi.org/10.1016/j.pep.2008.01.006
  • Backbone size w/o insert (bp) 12971
  • Total vector size (bp) 13243
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rpoZ
  • Alt name
    yloH
  • Alt name
    BSU_15690
  • GenBank ID
  • Entrez Gene
    rpoZ (a.k.a. BSU_15690, BSU15690)
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCGTTAAAGGCGACAATGTT
  • 3′ sequencing primer ACGCCTTTATAACGAACTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNG1256 was a gift from Peter Lewis (Addgene plasmid # 149710 ; http://n2t.net/addgene:149710 ; RRID:Addgene_149710)
  • For your References section:

    Molecular basis for RNA polymerase-dependent transcription complex recycling by the helicase-like motor protein HelD. Newing TP, Oakley AJ, Miller M, Dawson CJ, Brown SHJ, Bouwer JC, Tolun G, Lewis PJ. Nat Commun. 2020 Dec 18;11(1):6420. doi: 10.1038/s41467-020-20157-5. 10.1038/s41467-020-20157-5 PubMed 33339820