pLenti-mIFT88-EGFP
(Plasmid
#149697)
-
PurposeExpresses mouse IFT88-EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF1α-IRES-EGFP (IRES-EGFP removed)
- Backbone size w/o insert (bp) 9800
- Total vector size (bp) 12300
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameIFT88
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2501
-
Entrez GeneIft88 (a.k.a. AW552028, Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris)
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TTCTCAAGCCTCAGACAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-mIFT88-EGFP was a gift from Ken-Ichi Takemaru (Addgene plasmid # 149697 ; http://n2t.net/addgene:149697 ; RRID:Addgene_149697)