Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSETb-tVYN-TmΔ
(Plasmid #149694)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149694 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSETb
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2700
  • Total vector size (bp) 4726
  • Modifications to backbone
    Inserted at NdeI/EcoRI
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VenusΔC12-TmYcgRΔ-NLucΔ4
  • Alt name
    tVYN-TmΔ
  • Insert Size (bp)
    1965
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSETb-tVYN-TmΔ was a gift from Ming Hammond (Addgene plasmid # 149694 ; http://n2t.net/addgene:149694 ; RRID:Addgene_149694)
  • For your References section:

    Development of Ratiometric Bioluminescent Sensors for in Vivo Detection of Bacterial Signaling. Dippel AB, Anderson WA, Park JH, Yildiz FH, Hammond MC. ACS Chem Biol. 2020 Mar 25. doi: 10.1021/acschembio.9b00800. 10.1021/acschembio.9b00800 PubMed 32186367