Skip to main content
Addgene

pBbdCas9S_P0826S-sgRNAflaB
(Plasmid #149647)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149647 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBbdCas9S
  • Backbone manufacturer
    CJW lab
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB 5-alpha F' Iq
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9, lacI, sgRNAflaB
  • gRNA/shRNA sequence
    AAAATTTAAATTTCTGACTT
  • Species
    Synthetic
  • Promoter PflaB, PpQE30, P0826S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer Unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBbdCas9S_P0826S-sgRNAflaB was a gift from Christine Jacobs-Wagner (Addgene plasmid # 149647 ; http://n2t.net/addgene:149647 ; RRID:Addgene_149647)
  • For your References section:

    A CRISPR interference platform for selective downregulation of gene expression in Borrelia burgdorferi. Takacs CN, Scott M, Chang Y, Kloos ZA, Irnov I, Rosa PA, Liu J, Jacobs-Wagner C. Appl Environ Microbiol. 2020 Nov 30. pii: AEM.02519-20. doi: 10.1128/AEM.02519-20. 10.1128/AEM.02519-20 PubMed 33257311