Skip to main content
Addgene

pAct-GW-HygroR
(Plasmid #149610)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149610 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMK33-Act5c
  • Modifications to backbone
    MT promoter from pMK33 replaced with Act5c promoter
  • Vector type
    Insect Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gateway cassette (ccdb + Chlor.R.)
  • Promoter Act5c

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GAGCATTGCGGCTGATAAGG
  • 3′ sequencing primer CCTCGACTTCTCCTCCTCCT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Invitrogen

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAct-GW-HygroR was a gift from Norbert Perrimon (Addgene plasmid # 149610 ; http://n2t.net/addgene:149610 ; RRID:Addgene_149610)
  • For your References section:

    Precise genome engineering in Drosophila using prime editing. Bosch JA, Birchak G, Perrimon N. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118. 10.1073/pnas.2021996118 PubMed 33443210