DYRK1A/pTRE3G-FL-hXIST
(Plasmid #149608)

• Purpose: Express doxycycline-inducible full length of human XIST cDNA
• Depositing Lab: Jeanne Lawrence
• Publication: Jiang et al Nature. 2013 Aug 15;500(7462):296-300. doi: 10.1038/nature12394. Epub 2013 Jul 17.

Backbone

• Vector backbone: pTRE3G
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3431
• Total vector size (bp): 18515
• Vector type: Mammalian Expression
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: X-inactive specific transcript
• Alt name: XIST
• Species: H. sapiens (human)
• Insert Size (bp): 13730
• GenBank ID: NR_001564.2 NR_001564.2
• Entrez Gene: XIST (a.k.a. DXS1089, DXS399E, LINC00001, NCRNA00001, SXI1, swd66)
• Promoter: pTRE3G

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PciI (destroyed during cloning)
• 3′ cloning site: NheI (destroyed during cloning)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: GGAGCAGACATTCATATAGGTG

Resource Information

• Supplemental Documents:
  • DYRK1A-pTRE3G-FL-hXIST.gbk
  • cloning steps
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The human XIST cDNA sequence modified and built into the DYRK1A/pTRE3G-FL-hXIST vector was based on an XIST cDNA initially cloned by Dr. Carolyn Brown (also an author on Jiang et al., Nature, 2013).