pBbdCas9S(RBSmut)_Psyn-sgRNAflaB
(Plasmid #149588)

• Purpose: all-in-one CRISPRi vector for targeting B. burgdorferi flaB
• Depositing Lab: Christine Jacobs-Wagner
• Publication: Takacs et al Appl Environ Microbiol. 2020 Nov 30. pii: AEM.02519-20. doi: 10.1128/AEM.02519-20.

Backbone

• Vector backbone: pBbdCas9S(RBSmut)
• Backbone manufacturer: CJW lab
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB 5-alpha F' Iq
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9, lacI, sgRNAflaB
• gRNA/shRNA sequence: AAAATTTAAATTTCTGACTT
• Species: Synthetic
• Promoter: PflaB, PpQE30, Psyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: Unknown

Resource Information

• Supplemental Documents:
  • CJW7167_pBbdCas9S(RBSmut)_Psyn-sgRNAflaB.gbk.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC identified an IS element present in the backbone sequence. The depositing lab does not believe this impacts the functional use of the plasmid but requesting scientists should validate expected behavior prior to experimentation.