pAct-PE2-HygroR
(Plasmid
#149552)
-
PurposeExpression of PE2 enzyme under control of ubiquitous Actin5c promoter. Can be used to generate stable cell lines by Hygromycin selection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAct-GW-HygroR
-
Backbone manufacturerJustin Bosch
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE2
-
Alt namePrime editor 2
-
SpeciesSynthetic
-
Insert Size (bp)6354
- Promoter Act5c
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GAGCATTGCGGCTGATAAGG
- 3′ sequencing primer CCTCGACTTCTCCTCCTCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPE2 coding sequence is from pCMV-PE2 (Addgene 132775). David Liu lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct-PE2-HygroR was a gift from Norbert Perrimon (Addgene plasmid # 149552 ; http://n2t.net/addgene:149552 ; RRID:Addgene_149552) -
For your References section:
Precise genome engineering in Drosophila using prime editing. Bosch JA, Birchak G, Perrimon N. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118. 10.1073/pnas.2021996118 PubMed 33443210