pNos-PE2-attB
(Plasmid #149549)

• Purpose: Expression of PE2 enzyme under control of the germ cell specific nanos promoter. Can be used to generate transgenic flies with vermillion+ selection.
• Depositing Lab: Norbert Perrimon
• Publication: Bosch et al Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118.

Backbone

• Vector backbone: nos-Cas9
• Backbone manufacturer: Xingjie Ren, Norbert Perrimon, and Jian-Quan Ni
• Modifications to backbone: Digestion with XbaI/AvrII to remove Cas9 coding sequence
• Vector type: Insect Expression, CRISPR
• Selectable markers: vermillion+

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PE2
• Alt name: Prime editor 2
• Species: Synthetic
• Insert Size (bp): 6354
• Promoter: nanos (nos)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTAGTTGGCGCGTAGCTTT
• 3′ sequencing primer: GCACGGGATAACGCTCTAAA

Resource Information

• Supplemental Documents:
  • nos-PE2-attB.gbk
• A portion of this plasmid was derived from a plasmid made by: PE2 coding sequence PCR amplified from pCMV-PE2 (Addgene 132775). David Liu lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry